Skip to content

Michel Piccoli au théâtre

Au théâtre, un boulimique multicartes
Par Anne Diatkine

Chéreau, Brook, Bondy, Vilar… Piccoli aura accompagné tous ceux qui ont forgé l’art théâtral au XXe siècle.

Tous les acteurs le disent : partager le plateau avec Michel Piccoli était enthousiasmant. Nul autre que lui ne savait rendre son partenaire meilleur, le sauver en cas de défaillance, lui prêter secours, mais surtout lui donner des ailes. Cependant, lorsqu’il évoquait sa «carrière» au théâtre, mot qu’il n’employait d’ailleurs pas, il se contentait de dire qu’il avait eu de «la chance». La chance de travailler avec «des êtres d’exception», c’est ainsi qu’il qualifiait Peter Brook, Patrice Chéreau, Luc Bondy, Klaus Michael Gruber, Bob Wilson, et bien sûr André Engel, sans compter celle d’avoir débuté avec Jacques Audiberti, Jean Vilar, Jean-Marie Serreau, c’est-à-dire tous ceux qui ont forgé en France l’art théâtral du XXe siècle. Lorsqu’il égrenait ces noms, ce qui frappait, c’est que ces rencontres avaient créé, le plus souvent possible, un compagnonnage qui donnait lieu à de nombreuses explorations, plusieurs mises en scène et surtout une amitié. Michel Piccoli était à la recherche de maisons-théâtres, de lieux dont la fonction excédait celle de la seule représentation, ce qu’il trouva aux Bouffes du Nord où il joua une Cerisaie montée par Peter Brook qui fit date en 1981, ou encore au théâtre de Nanterre-Amandiers, refondé et dirigé par Patrice Chéreau et Catherine Tasca dans les années 80, sa «maison» avait-il confié à Libération. Où, sous la direction de Patrice Chéreau, il créa aussi bien Combat de nègre et de chiens, de Bernard-Marie Koltès, que la Suivante de Marivaux, avec une Jane Birkin débutante sur les planches, ou encore Terre étrangère d’Arthur Schnitzler, alors rarement monté et mis en scène par un jeune metteur en scène quasi inconnu en France, et révélé par ce spectacle : Luc Bondy.


Le Conte d’hiver, aux Amandiers, en 1988. Photo J. Ber. CHRISTOPHEL

Muet.
Il n’aimait pas les «cabots», mais il disait qu’il pouvait l’être, et le dire suffisait à lui interdire de tomber dans ce travers. Il pouvait tout jouer et il s’en amusait. Et sa polyvalence était tout sauf une évidence. Enfant, avait-il confié dans J’ai vécu dans mes rêves, un livre sous forme de lettres coécrit avec Gilles Jacob, il était muet. Cet enfant muet découvrit le théâtre dans un pensionnat près de Compiègne, classiquement grâce à des représentations de fin d’année, où il joua l’un des tailleurs des Habits neufs de l’empereur du conte d’Andersen. «Tout d’un coup, je me suis senti comme un poisson dans l’eau. Je racontais des histoires devant des gens qui m’écoutaient en se taisant.»

S’il n’a pas de doute sur sa vocation, il attend d’avoir 18 ans avant d’en faire part à ses parents, bourgeois artistes et musiciens, mais pas bohèmes du tout. On imagine une enfance triste, aussi triste qu’il devint un homme joyeux, grâce à la scène, disait-il. Il débute dans l’immédiat après-guerre alors que de nouvelles salles ouvrent et que le théâtre met toute son énergie à devenir un art populaire, aussi nécessaire «que le gaz et l’électricité» disait Jean Vilar. Sous la direction de Jean Vilar, justement, il joue Phèdre. Se brouille avec lui, car il n’hésite pas à se produire également dans un théâtre privé. Les deux hommes se réconcilieront plus tard.

Adieux.
Un sentiment d’euphorie et une énergie sans limite poussent parfois Michel Piccoli à jouer six pièces la même année. Si on ne doit garder qu’un seul nom de ces années 50, ce serait celui de Jean-Marie Serreau, le fondateur du Babylone, qui ouvre son théâtre avec deux pièces de Pirandello interprétées par Piccoli et Eléonore Hirt, avec qui l’acteur se mariera. Mais dans les années 60, c’est la France entière qui découvre que Dom Juan a ses traits mis en scène et filmé par Marcel Bluwal. De fait, chaque décennie, de nouvelles générations de spectateurs découvrent Michel Piccoli comme un acteur absolument contemporain, né aujourd’hui à l’art de la scène, même lorsqu’il jouait le Roi Lear, l’un de ses derniers rôles, dans une mise en scène d’André Engel, qui fut un succès considérable. Il avait pourtant résisté, affirmant que rien n’était plus pathétique qu’un vieil acteur faisant ses adieux ainsi. Son dernier rôle fut celui de Minetti dans la pièce du même nom de Thomas Bernhard, qui raconte justement l’histoire d’un acteur qui refuse absolument d’interpréter des classiques, même et surtout Lear.

পঞ্চাশহাজারশব্দ

পঞ্চাশ হাজার শব্দ লেখা হয়ে গেল। দাগ আজো চলছে। কে পড়ছে কে পড়ছে না, কে দেখছে কে দেখছে না, কে বলছে কে বলছে না, কোনো ব্যাপার নয়, দাগ চলছে এবং দাগ তার আপন গতিতেই যত দিন পারে চলবে। শব্দ যোগ হতে থাকবে, পঞ্চাশ হাজার ছাড়িয়ে, ষাট সত্তর আশি নব্বই একশ হাজার ছাড়িয়ে, অথবা যেকোনো দিন মুখ থুবড়ে পড়বে দাগ, যেকোনো কিছুর জন্য তৈরি দাগ এর লেখক। শুরু যখন করেছিলাম তখন এত শব্দের কথা ভাবিনি, কিন্তু দিনে দিনে এমন হল, আর কোথাও দাগ না কাটলেও দাগ কেটেছি দাগ এ।

দাগ এক বিন্যাস কি উপন্যাস জানি না। তবে দাগ এক এমন লেখা এমন এক নির্বিকল্প লেখা যা আমি কখনো শেষ করতে চাই না।

কলকাতা ২০শে মে ২০২০

সেদিন বিকেল তিনটা থেকেই আমি উদ্বিগ্ন। বুঝতে পারছিলাম কলকাতা ধ্বংসের মুখে দাঁড়িয়ে। আমি নিজে ১৯৯১ সালে চট্টগ্রামকে আরো ভয়ঙ্কর ভাবে ধ্বংস হতে দেখেছিলাম। প্রায় এক মাস আগে সেই ধ্বংসলীলার ঊনত্রিশ বছর স্মরণ করেছিলাম। এরপর রাত যখন এগারোটা আমাদের এখানে ঢাকায় তখন খবর পেতে শুরু করেছিলাম চব্বিশ পরগনা প্রায় সম্পূর্ণ সংহার করে কলকাতার বিভৎসতম রাতের ধ্বংসযজ্ঞের ছাপ স্পষ্ট হয়ে গোছে। খবর শুনে বুঝতে বাকি থাকেনি তারপরের দিন কীরকম লণ্ডভণ্ড কলকাতাকে আমাদের চোখের সামনে তুলে ধরবে আঁধার বিদীর্ণ করা বিকট সূর্য।

আখ্যান অনাখ্যান মিলেমিশে একাকার দেবেশ রায়

আখ্যান অনাখ্যান মিলেমিশে একাকার দেবেশ রায় আমার কাছে আমার অস্তিত্বের খুব কাছের একজন লেখক হয়ে উঠেছেন গত প্রায় ষোলো বছর ধরে। একটা এমন সম্পর্ক গড়ে উঠেছে যে তার মৃত্যুর খবর শুনে কান্নায় আমার কণ্ঠরুদ্ধ হয়েছে এবং এখনো যখন লিখছি পরের দিনের পড়ন্ত বেলায় তখনো আমার চোখ আর্দ্র হয়ে উঠছে গলা আর্ত হয়ে উঠছে বুঝতে পারছি দেবেশ রায়ের মৃত্যু আমার প্রাণপদার্থে যেআঘাত দিয়েছে তার তীব্রতা সত্তার বিদায়ের এমন বিদীর্ণতার সমান যেন কৃষ্ণবিবর। একথা বলা বড় বেশি বলা হয়ে যাচ্ছে মনে করার কোনো কারণ নেই যখন আমি জানি গদ্যের শিল্প এক জটিল আবর্ত যাকে ধরে রাখার সত্তা বিলীন হলে যেশূন্যতার সৃষ্টি হয় তার সমান অন্য কোনো শূন্যতার বেদনার সাথে আমি পরিচিত তো নইই আমার পরিচিত হওয়ার আর কোনো সম্ভাবনাও নেই।

Russian aesthetic: socialist realism curated for social media

Realists of the Soviet Fantasy
Sophie Pinkham

In Aleksandr Deineka’s painting Textile Workers (1927), three barefoot young women in simple shifts work in a light-filled blue-gray space, the rows of bobbins rendered as floating lozenges along the walls. The girl in the foreground, a skinny teenager, pulls a thread from a bobbin that seems to hang in the air. She faces us, but is unaware of our presence: we have the advantage, as if looking through a two-way mirror. On the right side of the canvas, another woman walks pensively into white nothingness. Deineka, one of the Soviet Union’s most successful artists, said the painting was intended to celebrate the rhythms of the factory, but today it looks more like a glimpse into an alternate universe: the early Soviet project, with its vertiginous hopes for a new world.

Aleksandr Deineka: Textile Workers, 1927


Aleksandr Deineka: Textile Workers, 1927 State Russian Museum

At the exhibit “Deineka/Samokhvalov,” on view this winter at St. Petersburg’s Manege Central Exhibition Hall, Textile Workers hung in a dim room, the painting lit so that it seemed to glow from within. The factory workers looked like ghosts from a future that never happened. But as presented at the Manege, the painting also evoked something intensely contemporary: a cell phone screen, luminous with color, solitary, easy to like. The dim lighting wasn’t helpful if you wanted to scrutinize Deineka’s technique, but it made the painting look great on Instagram. Welcome to a new Russian aesthetic: socialist realism curated for social media.


Aleksandr Samokhvalov: Portrait of a Pilot, 1933

The exhibition, a centerpiece of the eighth St. Petersburg International Cultural Forum, was imagined as a soccer match between two major Soviet painters from rival cities: Deineka, who lived in Moscow, and his Leningrad contemporary Aleksandr Samokhvalov, who is far less famous but more than held his own. The pale neoclassical façade of the Manege—which was the tsar’s riding hall and then the garage of the NKVD, the People’s Commissariat for Internal Affairs—was adorned with colored banners announcing the competition: Deineka (number 99, for his birth year of 1899) vs. Samokhvalov (born 1894 and thus number 94), Moscow vs. Leningrad. Arriving at the exhibition, you entered a stand of bleachers from which you could watch clips of Soviet athletes in slow motion, with atmospheric music piped in throughout the gallery. At the end of the show you emerged onto half an AstroTurf soccer field, complete with a Deineka sculpture of soccer players. The elderly female attendants familiar from every Russian museum no longer wore their customary fringed floral scarves and fuzzy sweaters; instead, they were dressed in Deineka or Samokhvalov soccer jerseys and American sneakers. It was gimmicky but cute, and it successfully conveyed the idea that the exhibition wasn’t a dry academic exercise but a popular event. Nearly a century on, socialist realism can finally be fun.


Aleksandr Deineka: The run, 1930 Fondazione Musei Civici di Venezia


Aleksandr Deineka: Agricultural Machinery Plant, 1940 The Institute of Russian Realist Art

Deineka/Samokhvalov
an exhibition at the Manege Central Exhibition Hall, St. Petersburg, November 18, 2019–January 19, 2020
(The Manege is offering online tours of a 3D model of the exhibition from April 10 to April 30 at manegespb.timepad.ru/events and a virtual tour at manege.spb.ru)
Catalog of the exhibition by Semyon Mikhailovsky, with essays by Elena Voronovich, Natalia Kozyreva, and Christina Kiaer.

পঁচিশে বৈশাখ ২০২০

স্কুল কলেজে রবীন্দ্রনাথ ঠাকুরকে গুরুত্বের সাথে নিতে হয়নি আমাকে, বলতে গেলে তেমন কোনো পরিচয়ও আমার ছিল না রবীন্দ্র পরিসরে, পড়াশোনা ছেড়ে দিয়েছি কবি হব শুনলেই লোকে বলত রবীন্দ্রনাথের কথা সেনাম শুনলেই তখন আমার বিরক্ত লাগত ক্ষোভ হত যেন পড়ালেখা ছেড়ে দিয়ে রবীন্দ্রনাথ ছাড়া আর কেউ কবি হয়নি, কিন্তু আমি যখন পড়তে শুরু করলাম রবীন্দ্রনাথকে তখন একেবারে খণ্ড ধরে ধরে গ্রন্থাগারে বসে পুরো রবীন্দ্র রচনাবলীই পড়ে ফেললাম, অবাক হলাম আদ্যন্ত রবীন্দ্রনাথ পড়ে আমি মুগ্ধ, আনন্দ হল সাহিত্য ও শিল্পের সমস্ত শাখায় এই অধিগম্যতা আমারো চাই, অসম্ভব জানি কিন্তু চাই, চাইতে তো কোনো অসুবিধা নেই, তবে একটি কথা একদম ভুলে থাকা যাবে না, রবীন্দ্রনাথ থেকে যেন অনেক অনেক দূরে চলে যাই আমি, কারণ ততটাই দূরে যাওয়া দরকার রবীন্দ্রনাথ থেকে যতটা দূরে যেতে পারলে রবীন্দ্রনাথ আর যেন আমাকে পীড়িত করতে না পারে, এবং সেলক্ষ্যে প্রথমেই আমি করেছি রবীন্দ্রনাথের লেখার নকল, সরাসরি সেরকম যেমন চিত্রশিল্পীরা ওল্ড মাস্টার্সদের ছবি নকল করে।

অপ্রকাশিত কবিতা | সুখ (অংশবিশেষ)

সুখ, যেন বা অদৃশ্য অঞ্চল। মেঘমুক্ত, দিনের প্রসন্ন আকাশ –শূন্যে রশ্মির হাসি। সুমন্দ বাতাসের মুগ্ধ নির্ভার মধুর তরঙ্গ এসে দু’চোখের পল্লব-পেলবতায় মিষ্টি রয়ের আবেশ রচে সময়ের তন্ময়ে হারিয়ে মেতে উঠেছে সহ্যাতীত নিঃস্ব রসে। কিছুই আর বলবার নেই – প্রশান্ত একটি নদীর স্থির বক্ষতরে ভেসে যাচ্ছে হালকা তালের তরী – আহা, কী সুন্দর এই ক্ষণটির তরল কল্লোল! অর্ধমগ্ন বালুচর – এক যেন দীর্ঘ অলস জলচর, রোদের আমেজে স্নায়ুসুপ্ত। এই ভাঙ্গা উচ্চতীর, বনচ্ছায়াপূর্ণতরু, প্রচ্ছন্ন কুটির – সব এসে মিশে গেছে বক্র শীর্ণ একখানি পথে, দূর গ্রাম হতে বিস্তীর্ণ শস্যক্ষেত্র পেরিয়ে সে এসে নেমেছে কোমল প্রশান্তির স্রোতে –তৃষ্ণার্ত জিহ্বা এক! আকণ্ঠমগন কৌতূকী গ্রামবধূদিগের উন্মন আলাপ আর উচ্চ মিষ্ট হাসি; জলতরঙ্গ আর মলয়জ কম্পনে : ‘মিশে-ভেসে’ এক স্তবপ্রাণ কবির অন্তরঙ্গ হয়ে উঠছে। আর কিছু বলার নেই – কী নিঃস্ব, বাঁধা নৌকার বৃদ্ধ জেলে! পিঠময় তাপমধুর রৌদ, জাল গাঁথে, নতশির স্মৃতির ধরনে। ঝাঁপিয়ে পড়বার একমাত্র আনন্দ উলঙ্গ বালকদিগের – বারবার – একাকার কলহাস্যে – ধৈর্যময়ী মাতার মতো একখানি নদী সয়ে যায় এইসব উচ্ছ্বল জীবনতাপের যন্ত্রণা। আহা দুপুর, আতপ্ত পবন – সরে যায় অস্তিত্বের পট – নদীটির দুইটি পার – কিন্তু শুধু স্বচ্ছতম নীলাভ্রের নির্মল বিস্তার – আলোর প্লাবন জলে স্থলে বনে; আর তাতেই বিচিত্র বর্ণের রেখা! গন্ধ বয় তীর-উপবন হতে আম্র মুকুলের। শ্রান্ত বিহঙ্গের স্বর থেকে থেকে ধ্বনির জল বহায় অন্তরতম প্রদেশে। কী আর বলা যায় – সুখ, যেন বা অদৃশ্য অঞ্চল।

এতে আমার কাজ হয়েছে, এর পর থেকে আমি সবসময় রবীন্দ্রনাথ থেকে দূরে, আর পঁচিশে বৈশাখ প্রতি বছরের সেই দিন যেদিন আমি আরো একবার সচেতন হই আমাকে রবীন্দ্রনাথ থেকে অনেক অনেক দূরে চলে যেতে হবে।

The COVID-19 response for vulnerable people in places affected by conflict and humanitarian crises

2019 novel coronavirus disease (COVID-19)

“If we don’t do anything, 500 million or 1 billion people could become infected. Of that, 3 million will possibly die… in low income countries (and) hostile environments.”

‘War Doctor’ David Nott says “we need to ramp up public health support in these countries”

Email: enquiries@davidnottfoundation.com – London, England – davidnottfoundation.com

[The Lancet link]

পহেলা বৈশাখ ২০২০

এবারের পহেলা বৈশাখ কেটেছে পুরোপুরি ঘরে। খাওয়াদাওয়াও সব ঘরে। এবারের খাওয়াদাওয়া খুবই পরিমিত। এদিক ওদিক ভুলভাল খাওয়াদাওয়া এবং বেশি খাবারের কোনো সম্ভাবনা এবার ছিল না।

কোথাও যাওয়া হয়নি। এবং ঘরেও কোনো বিশেষ উৎসবময় জামাকাপড় পরা হয়নি। প্রতিদিন ঘরে যেমন জামাকাপড় তাই পরে ঘরেই এবারের পহেলা বৈশাখ।

কোনো গান শোনা হয়নি। কিছু পড়া হয়নি। কিছু দেখা হয়নি। কারো সাথে কথা হয়নি। শুভেচ্ছা বিনিময় হয়নি। একেবারে নিষ্কর্মা এক পহেলা বৈশাখ। কিন্তু ধ্রুপদী উদযাপিত।

ভোরে

আলু ভর্তা
ফাইস্যা শুটকির ভর্তা
ডিম ভাজা
কয়েক দিন আগে রান্না করা গরুর মাংস
পান্তা ভাত
কাঁচা পেঁয়াজ
কাঁচা মরিচ
সুগন্ধি লেবু

সকালে

চা
মুড়ি

শেষ সকালে

কাঁচাতেঁতুলের মিষ্টি আচার

দুপুরে

৩/৪টি ভূমধ্যসাগরীয় কমলালেবু
পাকাতেঁতুলের মিষ্টি আচারের শরবত

সন্ধ্যায়

প্রথম পর্বে

লুচি
মটরডাল
চৈত্রসংক্রান্তির রেখে দেয়া সুক্তো
চা

দ্বিতীয় পর্বে

শিক কাবাব
২/১টি ক্ষীরা
৭৫০মি.লি ধানি বিয়ার

দাগ লক্ষ+ ভিউজ

এই পোস্ট যখন লিখতে বসেছি, মানে যখন শিরোনামটা লিখে ফেলেছি, তখন একটা খবর চোখে পড়ল সিওভিআইডিওয়াননাইন এর গ্রাসে বিশ্বে মৃত্যু ছাড়াল এক লক্ষ, পৃথিবীর বড় দুঃখের দিনে আর পোস্টটি লিখব কিনা, কিবোর্ড থেকে হাত সরিয়ে বসেছিলাম, তারপর আবার কিবোর্ড চলতে শুরু করল, মানে একথাটা লেখার জন্য, না এনিয়ে কিছু আজ আর লিখব না, শুধু সাম্প্রতিক একটি টুইট এবং দাগ নিয়ে আগের কিছু পোস্টের লিন্ক রেখে শেষ করব এই পোস্ট।

সহস্রাধিক দাগ
শতক পূর্ণ করে দাগ বন্ধ করে দিলে ভাল হত না মনে হচ্ছে আজ যখন সহস্রাধিক দাগ দেখা যাচ্ছে এবং কে বলতে পারে যদি সেদিনও সমাগত হয় যখন দশ সহস্রাধিক দাগ সম্পন্নের খবর দিয়ে আমাকে দাগ-এর এই অর্জনের কথা এই প্রাত্যহিক পাঠ-এ জানাতে পোস্ট তৈরি করতে হবে না।

বছর বছর দাগ
এই সেপ্টেম্বরের শুরুতে ছিল আত্মপ্রচার সেপ্টেম্বরের শেষদিকে এসেও আত্মপ্রচার। তিনশপয়ষট্টি যোগ তিনশপয়ষট্টি হয়ে গেল দুবছরের প্রতিদিন লিখে সাতশতিরিশ দাগ। ভেবেছিলাম একশ ‘দাগ’ লিখে ক্ষান্ত দেব পরে দেখলাম এটা চলছে পরে ভাবলাম বছর বছর চলে যাক ‘দাগ’ লিখে – দেখা যাক দুবছর তো চলে গেল আর কত বছর যায়, নাকি এই শেষ।

Genome of SARS-CoV-2

Bad News Wrapped in Protein: Inside the Coronavirus Genome

By Jonathan Corum and Carl Zimmer

A virus is “simply a piece of bad news wrapped up in protein,” the biologists Jean and Peter Medawar wrote in 1977.

In January, scientists deciphered a piece of very bad news: the genome of SARS-CoV-2, the virus that causes Covid-19. The sample came from a 41-year-old man who worked at the seafood market in Wuhan where the first cluster of cases appeared.

Researchers are now racing to make sense of this viral recipe, which could inspire drugs, vaccines and other tools to fight the ongoing pandemic.

A String of RNA

Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome.

The genome of the new coronavirus is less than 30,000 “letters” long. (The human genome is over 3 billion.) Scientists have identified genes for as many as 29 proteins, which carry out a range of jobs from making copies of the coronavirus to suppressing the body’s immune responses.

The first sequence of RNA letters reads:

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

This sequence recruits machinery inside the infected cell to read the RNA letters — a, c, g and u — and translate them into coronavirus proteins.

The full coronavirus genome and the proteins it encodes are shown below.

A Chain of Proteins · ORF1ab

The first viral protein created inside the infected cell is actually a chain of 16 proteins joined together. Two of these proteins act like scissors, snipping the links between the different proteins and freeing them to do their jobs.

Research on other coronaviruses has given scientists a good understanding of what some of the SARS-CoV-2 proteins do. But other proteins are far more mysterious, and some might do nothing at all.

Cellular Saboteur · NSP1

This protein slows down the infected cell’s production of its own proteins. This sabotage forces the cell to make more virus proteins and prevents it from assembling antiviral proteins that could stop the virus.

auggagagccuugucccugguuucaacgagaaaacacacguccaacucaguuugccuguuuuacagguucgcgacgugcucguacguggcuuuggagacuccguggaggaggucuuaucagaggcacgucaacaucuuaaagauggcacuuguggcuuaguagaaguugaaaaaggcguuuugccucaacuugaacagcccuauguguucaucaaacguucggaugcucgaacugcaccucauggucauguuaugguugagcugguagcagaacucgaaggcauucaguacggucguaguggugagacacuugguguccuugucccucaugugggcgaaauaccaguggcuuaccgcaagguucuucuucguaagaacgguaauaaaggagcugguggccauaguuacggcgccgaucuaaagucauuugacuuaggcgacgagcuuggcacugauccuuaugaagauuuucaagaaaacuggaacacuaaacauagcagugguguuacccgugaacucaugcgugagcuuaacggaggg

Mystery Protein · NSP2

Scientists aren’t sure what NSP2 does. The other proteins it attaches to may offer some clues. Two of them help move molecule-filled bubbles called endosomes around the cell.

gcauacacucgcuaugucgauaacaacuucuguggcccugauggcuacccucuugagugcauuaaagaccuucuagcacgugcugguaaagcuucaugcacuuuguccgaacaacuggacuuuauugacacuaagagggguguauacugcugccgugaacaugagcaugaaauugcuugguacacggaacguucugaaaagagcuaugaauugcagacaccuuuugaaauuaaauuggcaaagaaauuugacaccuucaauggggaauguccaaauuuuguauuucccuuaaauuccauaaucaagacuauucaaccaaggguugaaaagaaaaagcuugauggcuuuauggguagaauucgaucugucuauccaguugcgucaccaaaugaaugcaaccaaaugugccuuucaacucucaugaagugugaucauuguggugaaacuucauggcagacgggcgauuuuguuaaagccacuugcgaauuuuguggcacugagaauuugacuaaagaaggugccacuacuugugguuacuuaccccaaaaugcuguuguuaaaauuuauuguccagcaugucacaauucagaaguaggaccugagcauagucuugccgaauaccauaaugaaucuggcuugaaaaccauucuucguaaggguggucgcacuauugccuuuggaggcuguguguucucuuauguugguugccauaacaagugugccuauuggguuccacgugcuagcgcuaacauagguuguaaccauacagguguuguuggagaagguuccgaaggucuuaaugacaaccuucuugaaauacuccaaaaagagaaagucaacaucaauauuguuggugacuuuaaacuuaaugaagagaucgccauuauuuuggcaucuuuuucugcuuccacaagugcuuuuguggaaacugugaaagguuuggauuauaaagcauucaaacaaauuguugaauccugugguaauuuuaaaguuacaaaaggaaaagcuaaaaaaggugccuggaauauuggugaacagaaaucaauacugaguccucuuuaugcauuugcaucagaggcugcucguguuguacgaucaauuuucucccgcacucuugaaacugcucaaaauucugugcguguuuuacagaaggccgcuauaacaauacuagauggaauuucacaguauucacugagacucauugaugcuaugauguucacaucugauuuggcuacuaacaaucuaguuguaauggccuacauuacaggugguguuguucaguugacuucgcaguggcuaacuaacaucuuuggcacuguuuaugaaaaacucaaacccguccuugauuggcuugaagagaaguuuaaggaagguguagaguuucuuagagacgguugggaaauuguuaaauuuaucucaaccugugcuugugaaauugucgguggacaaauugucaccugugcaaaggaaauuaaggagaguguucagacauucuuuaagcuuguaaauaaauuuuuggcuuugugugcugacucuaucauuauugguggagcuaaacuuaaagccuugaauuuaggugaaacauuugucacgcacucaaagggauuguacagaaaguguguuaaauccagagaagaaacuggccuacucaugccucuaaaagccccaaaagaaauuaucuucuuagagggagaaacacuucccacagaaguguuaacagaggaaguugucuugaaaacuggugauuuacaaccauuagaacaaccuacuagugaagcuguugaagcuccauugguugguacaccaguuuguauuaacgggcuuauguugcucgaaaucaaagacacagaaaaguacugugcccuugcaccuaauaugaugguaacaaacaauaccuucacacucaaaggcggu

Untagging and Cutting · NSP3

NSP3 is a large protein that has two important jobs. One is cutting loose other viral proteins so they can do their own tasks. It also alters many of the infected cell’s proteins.

Normally, a healthy cell tags old proteins for destruction. But the coronavirus can remove those tags, changing the balance of proteins and possibly reducing the cell’s ability to fight the virus.

gcaccaacaaagguuacuuuuggugaugacacugugauagaagugcaagguuacaagagugugaauaucacuuuugaacuugaugaaaggauugauaaaguacuuaaugagaagugcucugccuauacaguugaacucgguacagaaguaaaugaguucgccuguguuguggcagaugcugucauaaaaacuuugcaaccaguaucugaauuacuuacaccacugggcauugauuuagaugaguggaguauggcuacauacuacuuauuugaugagucuggugaguuuaaauuggcuucacauauguauuguucuuucuacccuccagaugaggaugaagaagaaggugauugugaagaagaagaguuugagccaucaacucaauaugaguaugguacugaagaugauuaccaagguaaaccuuuggaauuuggugccacuucugcugcucuucaaccugaagaagagcaagaagaagauugguuagaugaugauagucaacaaacuguuggucaacaagacggcagugaggacaaucagacaacuacuauucaaacaauuguugagguucaaccucaauuagagauggaacuuacaccaguuguucagacuauugaagugaauaguuuuagugguuauuuaaaacuuacugacaauguauacauuaaaaaugcagacauuguggaagaagcuaaaaagguaaaaccaacagugguuguuaaugcagccaauguuuaccuuaaacauggaggagguguugcaggagccuuaaauaaggcuacuaacaaugccaugcaaguugaaucugaugauuacauagcuacuaauggaccacuuaaagugggugguaguuguguuuuaagcggacacaaucuugcuaaacacugucuucauguugucggcccaaauguuaacaaaggugaagacauucaacuucuuaagagugcuuaugaaaauuuuaaucagcacgaaguucuacuugcaccauuauuaucagcugguauuuuuggugcugacccuauacauucuuuaagaguuuguguagauacuguucgcacaaaugucuacuuagcugucuuugauaaaaaucucuaugacaaacuuguuucaagcuuuuuggaaaugaagagugaaaagcaaguugaacaaaagaucgcugagauuccuaaagaggaaguuaagccauuuauaacugaaaguaaaccuucaguugaacagagaaaacaagaugauaagaaaaucaaagcuuguguugaagaaguuacaacaacucuggaagaaacuaaguuccucacagaaaacuuguuacuuuauauugacauuaauggcaaucuucauccagauucugccacucuuguuagugacauugacaucacuuucuuaaagaaagaugcuccauauauagugggugauguuguucaagaggguguuuuaacugcugugguuauaccuacuaaaaaggcugguggcacuacugaaaugcuagcgaaagcuuugagaaaagugccaacagacaauuauauaaccacuuacccgggucaggguuuaaaugguuacacuguagaggaggcaaagacagugcuuaaaaaguguaaaagugccuuuuacauucuaccaucuauuaucucuaaugagaagcaagaaauucuuggaacuguuucuuggaauuugcgagaaaugcuugcacaugcagaagaaacacgcaaauuaaugccugucuguguggaaacuaaagccauaguuucaacuauacagcguaaauauaaggguauuaaaauacaagagggugugguugauuauggugcuagauuuuacuuuuacaccaguaaaacaacuguagcgucacuuaucaacacacuuaacgaucuaaaugaaacucuuguuacaaugccacuuggcuauguaacacauggcuuaaauuuggaagaagcugcucgguauaugagaucucucaaagugccagcuacaguuucuguuucuucaccugaugcuguuacagcguauaaugguuaucuuacuucuucuucuaaaacaccugaagaacauuuuauugaaaccaucucacuugcugguuccuauaaagauugguccuauucuggacaaucuacacaacuagguauagaauuucuuaagagaggugauaaaaguguauauuacacuaguaauccuaccacauuccaccuagauggugaaguuaucaccuuugacaaucuuaagacacuucuuucuuugagagaagugaggacuauuaagguguuuacaacaguagacaacauuaaccuccacacgcaaguuguggacaugucaaugacauauggacaacaguuugguccaacuuauuuggauggagcugauguuacuaaaauaaaaccucauaauucacaugaagguaaaacauuuuauguuuuaccuaaugaugacacucuacguguugaggcuuuugaguacuaccacacaacugauccuaguuuucuggguagguacaugucagcauuaaaucacacuaaaaaguggaaauacccacaaguuaaugguuuaacuucuauuaaaugggcagauaacaacuguuaucuugccacugcauuguuaacacuccaacaaauagaguugaaguuuaauccaccugcucuacaagaugcuuauuacagagcaagggcuggugaagcugcuaacuuuugugcacuuaucuuagccuacuguaauaagacaguaggugaguuaggugauguuagagaaacaaugaguuacuuguuucaacaugccaauuuagauucuugcaaaagagucuugaacgugguguguaaaacuuguggacaacagcagacaacccuuaaggguguagaagcuguuauguacaugggcacacuuucuuaugaacaauuuaagaaagguguucagauaccuuguacgugugguaaacaagcuacaaaauaucuaguacaacaggagucaccuuuuguuaugaugucagcaccaccugcucaguaugaacuuaagcaugguacauuuacuugugcuagugaguacacugguaauuaccaguguggucacuauaaacauauaacuucuaaagaaacuuuguauugcauagacggugcuuuacuuacaaaguccucagaauacaaagguccuauuacggauguuuucuacaaagaaaacaguuacacaacaaccauaaaaccaguuacuuauaaauuggaugguguuguuuguacagaaauugacccuaaguuggacaauuauuauaagaaagacaauucuuauuucacagagcaaccaauugaucuuguaccaaaccaaccauauccaaacgcaagcuucgauaauuuuaaguuuguaugugauaauaucaaauuugcugaugauuuaaaccaguuaacugguuauaagaaaccugcuucaagagagcuuaaaguuacauuuuucccugacuuaaauggugaugugguggcuauugauuauaaacacuacacacccucuuuuaagaaaggagcuaaauuguuacauaaaccuauuguuuggcauguuaacaaugcaacuaauaaagccacguauaaaccaaauaccugguguauacguugucuuuggagcacaaaaccaguugaaacaucaaauucguuugauguacugaagucagaggacgcgcagggaauggauaaucuugccugcgaagaucuaaaaccagucucugaagaaguaguggaaaauccuaccauacagaaagacguucuugaguguaaugugaaaacuaccgaaguuguaggagacauuauacuuaaaccagcaaauaauaguuuaaaaauuacagaagagguuggccacacagaucuaauggcugcuuauguagacaauucuagucuuacuauuaagaaaccuaaugaauuaucuagaguauuagguuugaaaacccuugcuacucaugguuuagcugcuguuaauagugucccuugggauacuauagcuaauuaugcuaagccuuuucuuaacaaaguuguuaguacaacuacuaacauaguuacacgguguuuaaaccguguuuguacuaauuauaugccuuauuucuuuacuuuauugcuacaauuguguacuuuuacuagaaguacaaauucuagaauuaaagcaucuaugccgacuacuauagcaaagaauacuguuaagagugucgguaaauuuugucuagaggcuucauuuaauuauuugaagucaccuaauuuuucuaaacugauaaauauuauaauuugguuuuuacuauuaaguguuugccuagguucuuuaaucuacucaaccgcugcuuuagguguuuuaaugucuaauuuaggcaugccuucuuacuguacugguuacagagaaggcuauuugaacucuacuaaugucacuauugcaaccuacuguacugguucuauaccuuguaguguuugucuuagugguuuagauucuuuagacaccuauccuucuuuagaaacuauacaaauuaccauuucaucuuuuaaaugggauuuaacugcuuuuggcuuaguugcagagugguuuuuggcauauauucuuuucacuagguuuuucuauguacuuggauuggcugcaaucaugcaauuguuuuucagcuauuuugcaguacauuuuauuaguaauucuuggcuuaugugguuaauaauuaaucuuguacaaauggccccgauuucagcuaugguuagaauguacaucuucuuugcaucauuuuauuauguauggaaaaguuaugugcauguuguagacgguuguaauucaucaacuuguaugauguguuacaaacguaauagagcaacaagagucgaauguacaacuauuguuaaugguguuagaagguccuuuuaugucuaugcuaauggagguaaaggcuuuugcaaacuacacaauuggaauuguguuaauugugauacauucugugcugguaguacauuuauuagugaugaaguugcgagagacuugucacuacaguuuaaaagaccaauaaauccuacugaccagucuucuuacaucguugauaguguuacagugaagaaugguuccauccaucuuuacuuugauaaagcuggucaaaagacuuaugaaagacauucucucucucauuuuguuaacuuagacaaccugagagcuaauaacacuaaagguucauugccuauuaauguuauaguuuuugaugguaaaucaaaaugugaagaaucaucugcaaaaucagcgucuguuuacuacagucagcuuaugugucaaccuauacuguuacuagaucaggcauuagugucugauguuggugauagugcggaaguugcaguuaaaauguuugaugcuuacguuaauacguuuucaucaacuuuuaacguaccaauggaaaaacucaaaacacuaguugcaacugcagaagcugaacuugcaaagaauguguccuuagacaaugucuuaucuacuuuuauuucagcagcucggcaaggguuuguugauucagauguagaaacuaaagauguuguugaaugucuuaaauugucacaucaaucugacauagaaguuacuggcgauaguuguaauaacuauaugcucaccuauaacaaaguugaaaacaugacaccccgugaccuuggugcuuguauugacuguagugcgcgucauauuaaugcgcagguagcaaaaagucacaacauugcuuugauauggaacguuaaagauuucaugucauugucugaacaacuacgaaaacaaauacguagugcugcuaaaaagaauaacuuaccuuuuaaguugacaugugcaacuacuagacaaguuguuaauguuguaacaacaaagauagcacuuaaggguggu

Bubble Maker · NSP4

Combining with other proteins, NSP4 helps build fluid-filled bubbles within infected cells. Inside these bubbles, parts for new copies of the virus are constructed.

aaaauuguuaauaauugguugaagcaguuaauuaaaguuacacuuguguuccuuuuuguugcugcuauuuucuauuuaauaacaccuguucaugucaugucuaaacauacugacuuuucaagugaaaucauaggauacaaggcuauugaugguggugucacucgugacauagcaucuacagauacuuguuuugcuaacaaacaugcugauuuugacacaugguuuagccagcguggugguaguuauacuaaugacaaagcuugcccauugauugcugcagucauaacaagagaaguggguuuugucgugccugguuugccuggcacgauauuacgcacaacuaauggugacuuuuugcauuucuuaccuagaguuuuuagugcaguugguaacaucuguuacacaccaucaaaacuuauagaguacacugacuuugcaacaucagcuuguguuuuggcugcugaauguacaauuuuuaaagaugcuucugguaagccaguaccauauuguuaugauaccaauguacuagaagguucuguugcuuaugaaaguuuacgcccugacacacguuaugugcucauggauggcucuauuauucaauuuccuaacaccuaccuugaagguucuguuagagugguaacaacuuuugauucugaguacuguaggcacggcacuugugaaagaucagaagcugguguuuguguaucuacuagugguagauggguacuuaacaaugauuauuacagaucuuuaccaggaguuuucugugguguagaugcuguaaauuuacuuacuaauauguuuacaccacuaauucaaccuauuggugcuuuggacauaucagcaucuauaguagcuggugguauuguagcuaucguaguaacaugccuugccuacuauuuuaugagguuuagaagagcuuuuggugaauacagucauguaguugccuuuaauacuuuacuauuccuuaugucauucacuguacucuguuuaacaccaguuuacucauucuuaccugguguuuauucuguuauuuacuuguacuugacauuuuaucuuacuaaugauguuucuuuuuuagcacauauucaguggaugguuauguucacaccuuuaguaccuuucuggauaacaauugcuuauaucauuuguauuuccacaaagcauuucuauugguucuuuaguaauuaccuaaagagacguguagucuuuaaugguguuuccuuuaguacuuuugaagaagcugcgcugugcaccuuuuuguuaaauaaagaaauguaucuaaaguugcguagugaugugcuauuaccucuuacgcaauauaauagauacuuagcucuuuauaauaaguacaaguauuuuaguggagcaauggauacaacuagcuacagagaagcugcuuguugucaucucgcaaaggcucucaaugacuucaguaacucagguucugauguucuuuaccaaccaccacaaaccucuaucaccucagcuguuuugcag

Protein Scissors · NSP5

This protein makes most of the cuts that free other NSP proteins to carry out their own jobs.

agugguuuuagaaaaauggcauucccaucugguaaaguugaggguuguaugguacaaguaacuugugguacaacuacacuuaacggucuuuggcuugaugacguaguuuacuguccaagacaugugaucugcaccucugaagacaugcuuaacccuaauuaugaagauuuacucauucguaagucuaaucauaauuucuugguacaggcugguaauguucaacucaggguuauuggacauucuaugcaaaauuguguacuuaagcuuaagguugauacagccaauccuaagacaccuaaguauaaguuuguucgcauucaaccaggacagacuuuuucaguguuagcuuguuacaaugguucaccaucugguguuuaccaaugugcuaugaggcccaauuucacuauuaaggguucauuccuuaaugguucaugugguaguguugguuuuaacauagauuaugacugugucucuuuuuguuacaugcaccauauggaauuaccaacuggaguucaugcuggcacagacuuagaagguaacuuuuauggaccuuuuguugacaggcaaacagcacaagcagcugguacggacacaacuauuacaguuaauguuuuagcuugguuguacgcugcuguuauaaauggagacaggugguuucucaaucgauuuaccacaacucuuaaugacuuuaaccuuguggcuaugaaguacaauuaugaaccucuaacacaagaccauguugacauacuaggaccucuuucugcucaaacuggaauugccguuuuagauaugugugcuucauuaaaagaauuacugcaaaaugguaugaauggacguaccauauuggguagugcuuuauuagaagaugaauuuacaccuuuugauguuguuagacaaugcucagguguuacuuuccaa

Bubble Factory · NSP6

Works with NSP3 and NSP4 to make virus factory bubbles.

agugcagugaaaagaacaaucaaggguacacaccacugguuguuacucacaauuuugacuucacuuuuaguuuuaguccagaguacucaauggucuuuguucuuuuuuuuguaugaaaaugccuuuuuaccuuuugcuauggguauuauugcuaugucugcuuuugcaaugauguuugucaaacauaagcaugcauuucucuguuuguuuuuguuaccuucucuugccacuguagcuuauuuuaauauggucuauaugccugcuaguugggugaugcguauuaugacaugguuggauaugguugauacuaguuugucugguuuuaagcuaaaagacuguguuauguaugcaucagcuguaguguuacuaauccuuaugacagcaagaacuguguaugaugauggugcuaggagaguguggacacuuaugaaugucuugacacucguuuauaaaguuuauuaugguaaugcuuuagaucaagccauuuccaugugggcucuuauaaucucuguuacuucuaacuacucagguguaguuacaacugucauguuuuuggccagagguauuguuuuuauguguguugaguauugcccuauuuucuucauaacugguaauacacuucaguguauaaugcuaguuuauuguuucuuaggcuauuuuuguacuuguuacuuuggccucuuuuguuuacucaaccgcuacuuuagacugacucuugguguuuaugauuacuuaguuucuacacaggaguuuagauauaugaauucacagggacuacucccacccaagaauagcauagaugccuucaaacucaacauuaaauuguuggguguugguggcaaaccuuguaucaaaguagccacuguacag

Copy Assistants · NSP7 and NSP8

These two proteins help NSP12 make new copies of the RNA genome, which can ultimately end up inside new viruses.

ucuaaaaugucagauguaaagugcacaucaguagucuuacucucaguuuugcaacaacucagaguagaaucaucaucuaaauugugggcucaauguguccaguuacacaaugacauucucuuagcuaaagauacuacugaagccuuugaaaaaaugguuucacuacuuucuguuuugcuuuccaugcagggugcuguagacauaaacaagcuuugugaagaaaugcuggacaacagggcaaccuuacaa

gcuauagccucagaguuuaguucccuuccaucauaugcagcuuuugcuacugcucaagaagcuuaugagcaggcuguugcuaauggugauucugaaguuguucuuaaaaaguugaagaagucuuugaauguggcuaaaucugaauuugaccgugaugcagccaugcaacguaaguuggaaaagauggcugaucaagcuaugacccaaauguauaaacaggcuagaucugaggacaagagggcaaaaguuacuagugcuaugcagacaaugcuuuucacuaugcuuagaaaguuggauaaugaugcacucaacaacauuaucaacaaugcaagagaugguuguguucccuugaacauaauaccucuuacaacagcagccaaacuaaugguugucauaccagacuauaacacauauaaaaauacgugugaugguacaacauuuacuuaugcaucagcauugugggaaauccaacagguuguagaugcagauaguaaaauuguucaacuuagugaaauuaguauggacaauucaccuaauuuagcauggccucuuauuguaacagcuuuaagggccaauucugcugucaaauuacag

At the Heart of the Cell · NSP9

This protein infiltrates tiny channels in the infected cell’s nucleus, which holds our own genome. It may be able to influence the movement of molecules in and out of the nucleus — but for what purpose, no one knows.

aauaaugagcuuaguccuguugcacuacgacagaugucuugugcugccgguacuacacaaacugcuugcacugaugacaaugcguuagcuuacuacaacacaacaaagggagguagguuuguacuugcacuguuauccgauuuacaggauuugaaaugggcuagauucccuaagagugauggaacugguacuaucuauacagaacuggaaccaccuuguagguuuguuacagacacaccuaaagguccuaaagugaaguauuuauacuuuauuaaaggauuaaacaaccuaaauagagguaugguacuugguaguuuagcugccacaguacgucuacaa

Genetic Camouflage · NSP10

Human cells have antiviral proteins that find viral RNA and shred it. This protein works with NSP16 to camouflage the virus’s genes so that they don’t get attacked.

gcugguaaugcaacagaagugccugccaauucaacuguauuaucuuucugugcuuuugcuguagaugcugcuaaagcuuacaaagauuaucuagcuagugggggacaaccaaucacuaauuguguuaagauguuguguacacacacugguacuggucaggcaauaacaguuacaccggaagccaauauggaucaagaauccuuugguggugcaucguguugucuguacugccguugccacauagaucauccaaauccuaaaggauuuugugacuuaaaagguaaguauguacaaauaccuacaacuugugcuaaugacccuguggguuuuacacuuaaaaacacagucuguaccgucugcgguauguggaaagguuauggcuguaguugugaucaacuccgcgaacccaugcuucag

Copy Machine · NSP12

This protein assembles genetic letters into new virus genomes. Researchers have found that the antiviral remdesivir interferes with NSP12 in other coronaviruses, and trials are now underway to see if the drug can treat Covid-19.

The infected cell begins reading the RNA sequence for NSP12:

ucagcugaugcacaaucguuuuuaaac…

Then it backtracks and reads c again, continuing as:

…cggguuugcgguguaagugcagcccgucuuacaccgugcggcacaggcacuaguacugaugucguauacagggcuuuugacaucuacaaugauaaaguagcugguuuugcuaaauuccuaaaaacuaauuguugucgcuuccaagaaaaggacgaagaugacaauuuaauugauucuuacuuuguaguuaagagacacacuuucucuaacuaccaacaugaagaaacaauuuauaauuuacuuaaggauuguccagcuguugcuaaacaugacuucuuuaaguuuagaauagacggugacaugguaccacauauaucacgucaacgucuuacuaaauacacaauggcagaccucgucuaugcuuuaaggcauuuugaugaagguaauugugacacauuaaaagaaauacuugucacauacaauuguugugaugaugauuauuucaauaaaaaggacugguaugauuuuguagaaaacccagauauauuacgcguauacgccaacuuaggugaacguguacgccaagcuuuguuaaaaacaguacaauucugugaugccaugcgaaaugcugguauuguugguguacugacauuagauaaucaagaucucaaugguaacugguaugauuucggugauuucauacaaaccacgccagguaguggaguuccuguuguagauucuuauuauucauuguuaaugccuauauuaaccuugaccagggcuuuaacugcagagucacauguugacacugacuuaacaaagccuuacauuaagugggauuuguuaaaauaugacuucacggaagagagguuaaaacucuuugaccguuauuuuaaauauugggaucagacauaccacccaaauuguguuaacuguuuggaugacagaugcauucugcauugugcaaacuuuaauguuuuauucucuacaguguucccaccuacaaguuuuggaccacuagugagaaaaauauuuguugaugguguuccauuuguaguuucaacuggauaccacuucagagagcuagguguuguacauaaucaggauguaaacuuacauagcucuagacuuaguuuuaaggaauuacuuguguaugcugcugacccugcuaugcacgcugcuucugguaaucuauuacuagauaaacgcacuacgugcuuuucaguagcugcacuuacuaacaauguugcuuuucaaacugucaaacccgguaauuuuaacaaagacuucuaugacuuugcugugucuaaggguuucuuuaaggaaggaaguucuguugaauuaaaacacuucuucuuugcucaggaugguaaugcugcuaucagcgauuaugacuacuaucguuauaaucuaccaacaaugugugauaucagacaacuacuauuuguaguugaaguuguugauaaguacuuugauuguuacgaugguggcuguauuaaugcuaaccaagucaucgucaacaaccuagacaaaucagcugguuuuccauuuaauaaaugggguaaggcuagacuuuauuaugauucaaugaguuaugaggaucaagaugcacuuuucgcauauacaaaacguaaugucaucccuacuauaacucaaaugaaucuuaaguaugccauuagugcaaagaauagagcucgcaccguagcuggugucucuaucuguaguacuaugaccaauagacaguuucaucaaaaauuauugaaaucaauagccgccacuagaggagcuacuguaguaauuggaacaagcaaauucuauggugguuggcacaacauguuaaaaacuguuuauagugauguagaaaacccucaccuuauggguugggauuauccuaaaugugauagagccaugccuaacaugcuuagaauuauggccucacuuguucuugcucgcaaacauacaacguguuguagcuugucacaccguuucuauagauuagcuaaugagugugcucaaguauugagugaaauggucauguguggcgguucacuauauguuaaaccagguggaaccucaucaggagaugccacaacugcuuaugcuaauaguguuuuuaacauuugucaagcugucacggccaauguuaaugcacuuuuaucuacugaugguaacaaaauugccgauaaguauguccgcaauuuacaacacagacuuuaugagugucucuauagaaauagagauguugacacagacuuugugaaugaguuuuacgcauauuugcguaaacauuucucaaugaugauacucucugacgaugcuguuguguguuucaauagcacuuaugcaucucaaggucuaguggcuagcauaaagaacuuuaagucaguucuuuauuaucaaaacaauguuuuuaugucugaagcaaaauguuggacugagacugaccuuacuaaaggaccucaugaauuuugcucucaacauacaaugcuaguuaaacagggugaugauuauguguaccuuccuuacccagauccaucaagaauccuaggggccggcuguuuuguagaugauaucguaaaaacagaugguacacuuaugauugaacgguucgugucuuuagcuauagaugcuuacccacuuacuaaacauccuaaucaggaguaugcugaugucuuucauuuguacuuacaauacauaagaaagcuacaugaugaguuaacaggacacauguuagacauguauucuguuaugcuuacuaaugauaacacuucaagguauugggaaccugaguuuuaugaggcuauguacacaccgcauacagucuuacag

Another sequence, NSP11, overlaps part of the same stretch of RNA. But it’s not clear if the tiny protein encoded by this gene has any function at all.

Unwinding RNA · NSP13

Normally, virus RNA is wound into intricate twists and turns. Scientists suspect that NSP13 unwinds it so that other proteins can read its sequence and make new copies.

gcuguuggggcuuguguucuuugcaauucacagacuucauuaagauguggugcuugcauacguagaccauucuuauguuguaaaugcuguuacgaccaugucauaucaacaucacauaaauuagucuugucuguuaauccguauguuugcaaugcuccagguugugaugucacagaugugacucaacuuuacuuaggagguaugagcuauuauuguaaaucacauaaaccacccauuaguuuuccauugugugcuaauggacaaguuuuugguuuauauaaaaauacauguguugguagcgauaauguuacugacuuuaaugcaauugcaacaugugacuggacaaaugcuggugauuacauuuuagcuaacaccuguacugaaagacucaagcuuuuugcagcagaaacgcucaaagcuacugaggagacauuuaaacugucuuaugguauugcuacuguacgugaagugcugucugacagagaauuacaucuuucaugggaaguugguaaaccuagaccaccacuuaaccgaaauuaugucuuuacugguuaucguguaacuaaaaacaguaaaguacaaauaggagaguacaccuuugaaaaaggugacuauggugaugcuguuguuuaccgagguacaacaacuuacaaauuaaauguuggugauuauuuugugcugacaucacauacaguaaugccauuaagugcaccuacacuagugccacaagagcacuauguuagaauuacuggcuuauacccaacacucaauaucucagaugaguuuucuagcaauguugcaaauuaucaaaagguugguaugcaaaaguauucuacacuccagggaccaccugguacugguaagagucauuuugcuauuggccuagcucucuacuacccuucugcucgcauaguguauacagcuugcucucaugccgcuguugaugcacuaugugagaaggcauuaaaauauuugccuauagauaaauguaguagaauuauaccugcacgugcucguguagaguguuuugauaaauucaaagugaauucaacauuagaacaguaugucuuuuguacuguaaaugcauugccugagacgacagcagauauaguugucuuugaugaaauuucaauggccacaaauuaugauuugaguguugucaaugccagauuacgugcuaagcacuauguguacauuggcgacccugcucaauuaccugcaccacgcacauugcuaacuaagggcacacuagaaccagaauauuucaauucaguguguagacuuaugaaaacuauagguccagacauguuccucggaacuugucggcguuguccugcugaaauuguugacacugugagugcuuugguuuaugauaauaagcuuaaagcacauaaagacaaaucagcucaaugcuuuaaaauguuuuauaaggguguuaucacgcaugauguuucaucugcaauuaacaggccacaaauaggcgugguaagagaauuccuuacacguaacccugcuuggagaaaagcugucuuuauuucaccuuauaauucacagaaugcuguagccucaaagauuuugggacuaccaacucaaacuguugauucaucacagggcucagaauaugacuaugucauauucacucaaaccacugaaacagcucacucuuguaauguaaacagauuuaauguugcuauuaccagagcaaaaguaggcauacuuugcauaaugucugauagagaccuuuaugacaaguugcaauuuacaagucuugaaauuccacguaggaauguggcaacuuuacaa

Viral Proofreader · NSP14

As NSP12 duplicates the coronavirus genome, it sometimes adds a wrong letter to the new copy. NSP14 cuts out these errors, so that the correct letter can be added instead.

gcugaaaauguaacaggacucuuuaaagauuguaguaagguaaucacuggguuacauccuacacaggcaccuacacaccucaguguugacacuaaauucaaaacugaagguuuauguguugacauaccuggcauaccuaaggacaugaccuauagaagacucaucucuaugauggguuuuaaaaugaauuaucaaguuaaugguuacccuaacauguuuaucacccgcgaagaagcuauaagacauguacgugcauggauuggcuucgaugucgaggggugucaugcuacuagagaagcuguugguaccaauuuaccuuuacagcuagguuuuucuacagguguuaaccuaguugcuguaccuacagguuauguugauacaccuaauaauacagauuuuuccagaguuagugcuaaaccaccgccuggagaucaauuuaaacaccucauaccacuuauguacaaaggacuuccuuggaauguagugcguauaaagauuguacaaauguuaagugacacacuuaaaaaucucucugacagagucguauuugucuuaugggcacauggcuuugaguugacaucuaugaaguauuuugugaaaauaggaccugagcgcaccuguugucuaugugauagacgugccacaugcuuuuccacugcuucagacacuuaugccuguuggcaucauucuauuggauuugauuacgucuauaauccguuuaugauugauguucaacaaugggguuuuacagguaaccuacaaagcaaccaugaucuguauugucaaguccaugguaaugcacauguagcuaguugugaugcaaucaugacuaggugucuagcuguccacgagugcuuuguuaagcguguugacuggacuauugaauauccuauaauuggugaugaacugaagauuaaugcggcuuguagaaagguucaacacaugguuguuaaagcugcauuauuagcagacaaauucccaguucuucacgacauugguaacccuaaagcuauuaaguguguaccucaagcugauguagaauggaaguucuaugaugcacagccuuguagugacaaagcuuauaaaauagaagaauuauucuauucuuaugccacacauucugacaaauucacagaugguguaugccuauuuuggaauugcaaugucgauagauauccugcuaauuccauuguuuguagauuugacacuagagugcuaucuaaccuuaacuugccugguugugaugguggcaguuuguauguaaauaaacaugcauuccacacaccagcuuuugauaaaagugcuuuuguuaauuuaaaacaauuaccauuuuucuauuacucugacaguccaugugagucucauggaaaacaaguagugucagauauagauuauguaccacuaaagucugcuacguguauaacacguugcaauuuagguggugcugucuguagacaucaugcuaaugaguacagauuguaucucgaugcuuauaacaugaugaucucagcuggcuuuagcuuguggguuuacaaacaauuugauacuuauaaccucuggaacacuuuuacaagacuucag

Cleaning Up · NSP15

Researchers suspect that this protein chops up leftover virus RNA as a way to hide from the infected cell’s antiviral defenses.

agaguuuagaaaauguggcuuuuaauguuguaaauaagggacacuuugauggacaacagggugaaguaccaguuucuaucauuaauaacacuguuuacacaaaaguugaugguguugauguagaauuguuugaaaauaaaacaacauuaccuguuaauguagcauuugagcuuugggcuaagcgcaacauuaaaccaguaccagaggugaaaauacucaauaauuuggguguggacauugcugcuaauacugugaucugggacuacaaaagagaugcuccagcacauauaucuacuauugguguuuguucuaugacugacauagccaagaaaccaacugaaacgauuugugcaccacucacugucuuuuuugaugguagaguugauggucaaguagacuuauuuagaaaugcccguaaugguguucuuauuacagaagguaguguuaaagguuuacaaccaucuguaggucccaaacaagcuagucuuaauggagucacauuaauuggagaagccguaaaaacacaguucaauuauuauaagaaaguugaugguguuguccaacaauuaccugaaacuuacuuuacucagaguagaaauuuacaagaauuuaaacccaggagucaaauggaaauugauuucuuagaauuagcuauggaugaauucauugaacgguauaaauuagaaggcuaugccuucgaacauaucguuuauggagauuuuagucauagucaguuaggugguuuacaucuacugauuggacuagcuaaacguuuuaaggaaucaccuuuugaauuagaagauuuuauuccuauggacaguacaguuaaaaacuauuucauaacagaugcgcaaacagguucaucuaaguguguguguucuguuauugauuuauuacuugaugauuuuguugaaauaauaaaaucccaagauuuaucuguaguuucuaagguugucaaagugacuauugacuauacagaaauuucauuuaugcuuugguguaaagauggccauguagaaacauuuuacccaaaauuacaa

More Camouflage · NSP16

NSP16 works with NSP10 to help the virus’s genes hide from proteins that chop up viral RNA.

ucuagucaagcguggcaaccggguguugcuaugccuaaucuuuacaaaaugcaaagaaugcuauuagaaaagugugaccuucaaaauuauggugauagugcaacauuaccuaaaggcauaaugaugaaugucgcaaaauauacucaacugugucaauauuuaaacacauuaacauuagcuguacccuauaauaugagaguuauacauuuuggugcugguucugauaaaggaguugcaccagguacagcuguuuuaagacagugguugccuacggguacgcugcuugucgauucagaucuuaaugacuuugucucugaugcagauucaacuuugauuggugauugugcaacuguacauacagcuaauaaaugggaucucauuauuagugauauguacgacccuaagacuaaaaauguuacaaaagaaaaugacucuaaagaggguuuuuucacuuacauuuguggguuuauacaacaaaagcuagcucuuggagguuccguggcuauaaagauaacagaacauucuuggaaugcugaucuuuauaagcucaugggacacuucgcaugguggacagccuuuguuacuaaugugaaugcgucaucaucugaagcauuuuuaauuggauguaauuaucuuggcaaaccacgcgaacaaauagaugguuaugucaugcaugcaaauuacauauuuuggaggaauacaaauccaauucaguugucuuccuauucuuuauuugacaugaguaaauuuccccuuaaauuaagggguacugcuguuaugucuuuaaaagaaggucaaaucaaugauaugauuuuaucucuucuuaguaaagguagacuuauaauuagagaaaacaacagaguuguuauuucuagugauguucuuguuaacaacuaaacgaaca

Spike Protein · S

The spike protein is one of four structural proteins — S, E, M and N — that form the outer layer of the coronavirus and protect the RNA inside. Structural proteins also help assemble and release new copies of the virus.

The S proteins form prominent spikes on the surface of the virus by arranging themselves in groups of three. These crownlike spikes give coronaviruses their name.

Part of the spike can extend and attach to a protein called ACE2 (in yellow below), which appears on particular cells in the human airway. The virus can then invade the cell.

The gene for the spike protein in SARS-CoV-2 has an insertion of 12 genetic letters: ccucggcgggca. This mutation may help the spikes bind tightly to human cells — a crucial step in its evolution from a virus that infected bats and other species.

A number of scientific teams are now designing vaccines that could prevent the spikes from attaching to human cells.

auguuuguuuuucuuguuuuauugccacuagucucuagucaguguguuaaucuuacaaccagaacucaauuacccccugcauacacuaauucuuucacacgugguguuuauuacccugacaaaguuuucagauccucaguuuuacauucaacucaggacuuguucuuaccuuucuuuuccaauguuacuugguuccaugcuauacaugucucugggaccaaugguacuaagagguuugauaacccuguccuaccauuuaaugaugguguuuauuuugcuuccacugagaagucuaacauaauaagaggcuggauuuuugguacuacuuuagauucgaagacccagucccuacuuauuguuaauaacgcuacuaauguuguuauuaaagucugugaauuucaauuuuguaaugauccauuuuuggguguuuauuaccacaaaaacaacaaaaguuggauggaaagugaguucagaguuuauucuagugcgaauaauugcacuuuugaauaugucucucagccuuuucuuauggaccuugaaggaaaacaggguaauuucaaaaaucuuagggaauuuguguuuaagaauauugaugguuauuuuaaaauauauucuaagcacacgccuauuaauuuagugcgugaucucccucaggguuuuucggcuuuagaaccauugguagauuugccaauagguauuaacaucacuagguuucaaacuuuacuugcuuuacauagaaguuauuugacuccuggugauucuucuucagguuggacagcuggugcugcagcuuauuauguggguuaucuucaaccuaggacuuuucuauuaaaauauaaugaaaauggaaccauuacagaugcuguagacugugcacuugacccucucucagaaacaaaguguacguugaaauccuucacuguagaaaaaggaaucuaucaaacuucuaacuuuagaguccaaccaacagaaucuauuguuagauuuccuaauauuacaaacuugugcccuuuuggugaaguuuuuaacgccaccagauuugcaucuguuuaugcuuggaacaggaagagaaucagcaacuguguugcugauuauucuguccuauauaauuccgcaucauuuuccacuuuuaaguguuauggagugucuccuacuaaauuaaaugaucucugcuuuacuaaugucuaugcagauucauuuguaauuagaggugaugaagucagacaaaucgcuccagggcaaacuggaaagauugcugauuauaauuauaaauuaccagaugauuuuacaggcugcguuauagcuuggaauucuaacaaucuugauucuaagguuggugguaauuauaauuaccuguauagauuguuuaggaagucuaaucucaaaccuuuugagagagauauuucaacugaaaucuaucaggccgguagcacaccuuguaaugguguugaagguuuuaauuguuacuuuccuuuacaaucauaugguuuccaacccacuaaugguguugguuaccaaccauacagaguaguaguacuuucuuuugaacuucuacaugcaccagcaacuguuuguggaccuaaaaagucuacuaauuugguuaaaaacaaaugugucaauuucaacuucaaugguuuaacaggcacagguguucuuacugagucuaacaaaaaguuucugccuuuccaacaauuuggcagagacauugcugacacuacugaugcuguccgugauccacagacacuugagauucuugacauuacaccauguucuuuugguggugucaguguuauaacaccaggaacaaauacuucuaaccagguugcuguucuuuaucaggauguuaacugcacagaagucccuguugcuauucaugcagaucaacuuacuccuacuuggcguguuuauucuacagguucuaauguuuuucaaacacgugcaggcuguuuaauaggggcugaacaugucaacaacucauaugagugugacauacccauuggugcagguauaugcgcuaguuaucagacucagacuaauucuccucggcgggcacguaguguagcuagucaauccaucauugccuacacuaugucacuuggugcagaaaauucaguugcuuacucuaauaacucuauugccauacccacaaauuuuacuauuaguguuaccacagaaauucuaccagugucuaugaccaagacaucaguagauuguacaauguacauuuguggugauucaacugaaugcagcaaucuuuuguugcaauauggcaguuuuuguacacaauuaaaccgugcuuuaacuggaauagcuguugaacaagacaaaaacacccaagaaguuuuugcacaagucaaacaaauuuacaaaacaccaccaauuaaagauuuuggugguuuuaauuuuucacaaauauuaccagauccaucaaaaccaagcaagaggucauuuauugaagaucuacuuuucaacaaagugacacuugcagaugcuggcuucaucaaacaauauggugauugccuuggugauauugcugcuagagaccucauuugugcacaaaaguuuaacggccuuacuguuuugccaccuuugcucacagaugaaaugauugcucaauacacuucugcacuguuagcggguacaaucacuucugguuggaccuuuggugcaggugcugcauuacaaauaccauuugcuaugcaaauggcuuauagguuuaaugguauuggaguuacacagaauguucucuaugagaaccaaaaauugauugccaaccaauuuaauagugcuauuggcaaaauucaagacucacuuucuuccacagcaagugcacuuggaaaacuucaagauguggucaaccaaaaugcacaagcuuuaaacacgcuuguuaaacaacuuagcuccaauuuuggugcaauuucaaguguuuuaaaugauauccuuucacgucuugacaaaguugaggcugaagugcaaauugauagguugaucacaggcagacuucaaaguuugcagacauaugugacucaacaauuaauuagagcugcagaaaucagagcuucugcuaaucuugcugcuacuaaaaugucagaguguguacuuggacaaucaaaaagaguugauuuuuguggaaagggcuaucaucuuauguccuucccucagucagcaccucaugguguagucuucuugcaugugacuuaugucccugcacaagaaaagaacuucacaacugcuccugccauuugucaugauggaaaagcacacuuuccucgugaaggugucuuuguuucaaauggcacacacugguuuguaacacaaaggaauuuuuaugaaccacaaaucauuacuacagacaacacauuugugucugguaacugugauguuguaauaggaauugucaacaacacaguuuaugauccuuugcaaccugaauuagacucauucaaggaggaguuagauaaauauuuuaagaaucauacaucaccagauguugauuuaggugacaucucuggcauuaaugcuucaguuguaaacauucaaaaagaaauugaccgccucaaugagguugccaagaauuuaaaugaaucucucaucgaucuccaagaacuuggaaaguaugagcaguauauaaaauggccaugguacauuuggcuagguuuuauagcuggcuugauugccauaguaauggugacaauuaugcuuugcuguaugaccaguugcuguaguugucucaagggcuguuguucuuguggauccugcugcaaauuugaugaagacgacucugagccagugcucaaaggagucaaauuacauuacacauaaacgaacuu

Escape Artist · ORF3a

The SARS-CoV-2 genome also encodes a group of so-called “accessory proteins.” They help change the environment inside the infected cell to make it easier for the virus to replicate.

The ORF3a protein pokes a hole in the membrane of an infected cell, making it easier for new viruses to escape. It also triggers inflammation, one of the most dangerous symptoms of Covid-19.

auggauuuguuuaugagaaucuucacaauuggaacuguaacuuugaagcaaggugaaaucaaggaugcuacuccuucagauuuuguucgcgcuacugcaacgauaccgauacaagccucacucccuuucggauggcuuauuguuggcguugcacuucuugcuguuuuucagagcgcuuccaaaaucauaacccucaaaaagagauggcaacuagcacucuccaaggguguucacuuuguuugcaacuugcuguuguuguuuguaacaguuuacucacaccuuuugcucguugcugcuggccuugaagccccuuuucucuaucuuuaugcuuuagucuacuucuugcagaguauaaacuuuguaagaauaauaaugaggcuuuggcuuugcuggaaaugccguuccaaaaacccauuacuuuaugaugccaacuauuuucuuugcuggcauacuaauuguuacgacuauuguauaccuuacaauaguguaacuucuucaauugucauuacuucaggugauggcacaacaaguccuauuucugaacaugacuaccagauuggugguuauacugaaaaaugggaaucuggaguaaaagacuguguuguauuacacaguuacuucacuucagacuauuaccagcuguacucaacucaauugaguacagacacugguguugaacauguuaccuucuucaucuacaauaaaauuguugaugagccugaagaacauguccaaauucacacaaucgacgguucauccggaguuguuaauccaguaauggaaccaauuuaugaugaaccgacgacgacuacuagcgugccuuuguaagcacaagcugaugaguacgaacuu

ORF3b overlaps the same RNA, but scientists aren’t sure if SARS-CoV-2 uses this gene to make proteins.

Envelope Protein · E

The envelope protein is a structural protein that helps form the oily bubble of the virus. It may also have jobs to do once the virus is inside the cell. Researchers have found that it latches onto proteins that help turn our own genes on and off. It’s possible that pattern changes when the E protein interferes.

auguacucauucguuucggaagagacagguacguuaauaguuaauagcguacuucuuuuucuugcuuucgugguauucuugcuaguuacacuagccauccuuacugcgcuucgauugugugcguacugcugcaauauuguuaacgugagucuuguaaaaccuucuuuuuacguuuacucucguguuaaaaaucugaauucuucuagaguuccugaucuucuggucuaaacgaacuaaauauuauauuaguuuuucuguuuggaacuuuaauuuuagcc

Membrane Protein · M

Another structural protein that forms part of the outer coat of the virus.

auggcagauuccaacgguacuauuaccguugaagagcuuaaaaagcuccuugaacaauggaaccuaguaauagguuuccuauuccuuacauggauuugucuucuacaauuugccuaugccaacaggaauagguuuuuguauauaauuaaguuaauuuuccucuggcuguuauggccaguaacuuuagcuuguuuugugcuugcugcuguuuacagaauaaauuggaucaccgguggaauugcuaucgcaauggcuugucuuguaggcuugauguggcucagcuacuucauugcuucuuucagacuguuugcgcguacgcguuccauguggucauucaauccagaaacuaacauucuucucaacgugccacuccauggcacuauucugaccagaccgcuucuagaaagugaacucguaaucggagcugugauccuucguggacaucuucguauugcuggacaccaucuaggacgcugugacaucaaggaccugccuaaagaaaucacuguugcuacaucacgaacgcuuucuuauuacaaauugggagcuucgcagcguguagcaggugacucagguuuugcugcauacagucgcuacaggauuggcaacuauaaauuaaacacagaccauuccaguagcagugacaauauugcuuugcuuguacaguaagugacaacag

Signal Blocker · ORF6

This accessory protein blocks signals that the infected cell would send out to the immune system. It also blocks some of the cell’s own virus-fighting proteins, the same ones targeted by other viruses such as polio and influenza.

auguuucaucucguugacuuucagguuacuauagcagagauauuacuaauuauuaugaggacuuuuaaaguuuccauuuggaaucuugauuacaucauaaaccucauaauuaaaaauuuaucuaagucacuaacugagaauaaauauucucaauuagaugaagagcaaccaauggagauugauuaaacgaac

Virus Liberator · ORF7a

When new viruses try to escape a cell, the cell can snare them with proteins called tetherin. Some research suggests that ORF7a cuts down an infected cell’s supply of tetherin, allowing more of the viruses to escape. Researchers have also found that the protein can trigger infected cells to commit suicide — which contributes to the damage Covid-19 causes to the lungs.

augaaaauuauucuuuucuuggcacugauaacacucgcuacuugugagcuuuaucacuaccaagaguguguuagagguacaacaguacuuuuaaaagaaccuugcucuucuggaacauacgagggcaauucaccauuucauccucuagcugauaacaaauuugcacugacuugcuuuagcacucaauuugcuuuugcuuguccugacggcguaaaacacgucuaucaguuacgugccagaucaguuucaccuaaacuguucaucagacaagaggaaguucaagaacuuuacucuccaauuuuucuuauuguugcggcaauaguguuuauaacacuuugcuucacacucaaaagaaagacagaaugauugaacuuucauuaauugacuucuauuugugcuuuuuagccuuucugcuauuccuuguuuuaauuaugcuuauuaucuuuugguucucacuugaacugcaagaucauaaugaaacuugucacgccuaaacgaac

ORF7b overlaps this same stretch of RNA, but it’s not clear what, if anything, the gene does.

Mystery Protein · ORF8

The gene for this accessory protein is dramatically different in SARS-CoV-2 than in other coronaviruses. Researchers are debating what it does.

augaaauuucuuguuuucuuaggaaucaucacaacuguagcugcauuucaccaagaauguaguuuacagucauguacucaacaucaaccauauguaguugaugacccguguccuauucacuucuauucuaaaugguauauuagaguaggagcuagaaaaucagcaccuuuaauugaauugugcguggaugaggcugguucuaaaucacccauucaguacaucgauaucgguaauuauacaguuuccuguuuaccuuuuacaauuaauugccaggaaccuaaauuggguagucuuguagugcguuguucguucuaugaagacuuuuuagaguaucaugacguucguguuguuuuagauuucaucuaaacgaacaaacuaaa

Nucleocapsid Protein · N

The N protein protects the virus RNA, keeping it stable inside the virus. Many N proteins link together in a long spiral, wrapping and coiling the RNA:

augucugauaauggaccccaaaaucagcgaaaugcaccccgcauuacguuugguggacccucagauucaacuggcaguaaccagaauggagaacgcaguggggcgcgaucaaaacaacgucggccccaagguuuacccaauaauacugcgucuugguucaccgcucucacucaacauggcaaggaagaccuuaaauucccucgaggacaaggcguuccaauuaacaccaauagcaguccagaugaccaaauuggcuacuaccgaagagcuaccagacgaauucgugguggugacgguaaaaugaaagaucucaguccaagaugguauuucuacuaccuaggaacugggccagaagcuggacuucccuauggugcuaacaaagacggcaucauauggguugcaacugagggagccuugaauacaccaaaagaucacauuggcacccgcaauccugcuaacaaugcugcaaucgugcuacaacuuccucaaggaacaacauugccaaaaggcuucuacgcagaagggagcagaggcggcagucaagccucuucucguuccucaucacguagucgcaacaguucaagaaauucaacuccaggcagcaguaggggaacuucuccugcuagaauggcuggcaauggcggugaugcugcucuugcuuugcugcugcuugacagauugaaccagcuugagagcaaaaugucugguaaaggccaacaacaacaaggccaaacugucacuaagaaaucugcugcugaggcuucuaagaagccucggcaaaaacguacugccacuaaagcauacaauguaacacaagcuuucggcagacgugguccagaacaaacccaaggaaauuuuggggaccaggaacuaaucagacaaggaacugauuacaaacauuggccgcaaauugcacaauuugcccccagcgcuucagcguucuucggaaugucgcgcauuggcauggaagucacaccuucgggaacgugguugaccuacacaggugccaucaaauuggaugacaaagauccaaauuucaaagaucaagucauuuugcugaauaagcauauugacgcauacaaaacauucccaccaacagagccuaaaaaggacaaaaagaagaaggcugaugaaacucaagccuuaccgcagagacagaagaaacagcaaacugugacucuucuuccugcugcagauuuggaugauuucuccaaacaauugcaacaauccaugagcagugcugacucaacucaggccuaaacucaugcagaccacacaaggcag

The accessory proteins ORF9b and ORF9c overlap this same stretch of RNA. ORF9b blocks interferon, a key molecule in the defense against viruses, but it’s not clear if ORF9c is used at all.

Mystery Protein · ORF10

Close relatives of the SARS-CoV-2 virus don’t have the gene for this tiny accessory protein, so it’s hard to know what it’s for yet — or even if the virus makes proteins from it.

augggcuauauaaacguuuucgcuuuuccguuuacgauauauagucuacucuugugcagaaugaauucucguaacuacauagcacaaguagauguaguuaacuuuaaucucacauag

End of the Line

The coronavirus genome ends with a snippet of RNA that stops the cell’s protein-making machinery. It then trails away as a repeating sequence of aaaaaaaaaaaaa

caaucuuuaaucaguguguaacauuagggaggacuugaaagagccaccacauuuucaccgaggccacgcggaguacgaucgaguguacagugaacaaugcuagggagagcugccuauauggaagagcccuaauguguaaaauuaauuuuaguagugcuauccccaugugauuuuaauagcuucuuaggagaaugacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

Note: The four letters of DNA are A, C, G and T. In RNA molecules like the coronavirus genome, the T (thymine) is replaced with U (uracil).

Sources: Fan Wu et al., Nature; National Center for Biotechnology Information; Dr. David Gordon, University of California, San Francisco; Dr. Matthew B. Frieman and Dr. Stuart Weston, University of Maryland School of Medicine; Dr. Pleuni Pennings, San Francisco State University; David Haussler and Jason Fernandes, U.C. Santa Cruz Genomics Institute; Journal of Virology; Annual Review of Virology.

Model sources: Coronavirus by Maria Voigt, RCSB Protein Data Bank headquartered at Rutgers University–New Brunswick; Ribosome from Heena Khatter et al., Nature; Proteins from Yang Zhang’s Research Group, University of Michigan.

https://platform.twitter.com/widgets.js